Help

SCHNEIDER-2

DSMZ: ACC-130

Species: Drosophila melanogaster (insect)

Cell type:

Incubation medium: 45% Schneider's Drosophila medium + 45% TC-100 medium + 10% h.i. FBS

Morphology: small adherent cells growing in monolayers; a small number of cells is also in suspension

COI DNA Barcoding Report

Help

Cell line: SCHNEIDER-2

ACC-No.: 130

Date of analysis: 13.10.2014

DNA processing number:

Methode: DNA Barcoding by PCR amplification of 5┬┤coding region of cytochrome c oxidase I (658 bp fragment size). Cycle sequencing of respective PCR products revealed following assignment upon submission to BOLD (Ratnasingham, S., Hebert, P. D. N. (2007) BOLD: The Barcode of Life Data System (www.Barcodinglife.org). Molecular Ecology Notes, 2007; 7(3): 355-364

Primer:

1x LepF1_t1: ATT TAG GTG ACA CTA TAG ATT CAA CCA ATC ATA AAG ATA TTG G

1x VF1_t1: ATT TAG GTG ACA CTA TAG TCT CAA CCA ACC ACA AAG ACA TTG G

1x VF1d_t1: ATT TAG GTG ACA CTA TAG TCT CAA CCA ACC ACA ARG AYA TYG G

3x VF1i_t1: ATT TAG GTG ACA CTA TAG TCT CAA CCA ACC ANA ANG ANA TNG G

1x LepR1_t1: TAA TAC GAC TCA CTA TAG GGT AAA CTT CTG GAT GTC CAA AAA ATC A

1x VR1d_t1: TAA TAC GAC TCA CTA TAG GGT AGA CTT CTG GGT GGC CRA ARA AYC A

1x VR1_t1: TAA TAC GAC TCA CTA TAG GGT AGA CTT CTG GGT GGC CAA AGA ATC A

3x VR1i_t1: TAA TAC GAC TCA CTA TAG GGT AGA CTT CTG GGT GNC CNA ANA ANC A

Sequence:

5`-TTWTTWWRGGGACACTATAGWYTCAACCAAYCAYAAAGAYATTGGAACTTTATATTTTAT

TTTTGGAGCTTGAGCTGGAATAGTTGGAACATCTTTAAGAATTTTAATTCGAGCTGAATT

AGGACATCCTGGAGCATTAATTGGAGATGATCAAATTTATAATGTAATTGTAACTGCACA

TGCTTTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGTGGATTTGGAAATTG

ATTAGTGCCTTTAATATTAGGTGCTCCTGATATAGCATTCCCACGAATAAATAATATAAG

ATTTTGACTACTACCTCCTGCTCTTTCTTTACTATTAGTAAGTAGAATAGTTGAAAATGG

AGCTGGAACAGGATGAACTGTTTATCCACCTTTATCCGCTGGAATTGCTCATGGTGGAGC

TTCAGTTGATTTAGCTATTTTTTCTCTACATTTAGCAGGGATTTCTTCAATTTTAGGAGC

TGTAAATTTTATTACAACTGTAATTAATATACGATCAACAGGAATTTCATTAGATCGTAT

ACCTTTATTTGTTTGATCAGTAGTTATTACTGCTTTATTATTATTATTATCACTTCCAGT

ACTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGA

CCMAGSGGGARGGARGGARGAWTCCCWTYTTTWWWAYCAAMMWTTATATTKKTATTTYTK SCMWC-3`

Taxonomic Level Taxon Assignment Probability of Placement (%)
Phylum Arthropoda 100
Class Insecta 100
Order Diptera 100
Family Drosophilidae 100
Genus Drosophila 100
Species

Drosophila

melanogaster

100

Identification Summary:

Search Result: The submitted sequence has been matched to Drosophila melanogaster. This identification is solid unless there is a very closely allied congeneric species that has not yet been analyzed. Such cases are rare.

Download as PDF (beta)