Help

LLC-PK1

DSMZ: ACC-637

Species: Sus scrofa (other (pig))

Cell type: kidney

Incubation medium: 90% Dulbeccoïs MEM + 10% h.i. FBS

Morphology: epitheloid cells growing adherently in monolayers

COI DNA Barcoding Report

Help

Cell line: LLC-PK1

ACC-No.: 637

Date of analysis: 13.10.2014

DNA processing number:

Methode: DNA Barcoding by PCR amplification of 5┬┤coding region of cytochrome c oxidase I (658 bp fragment size). Cycle sequencing of respective PCR products revealed following assignment upon submission to BOLD (Ratnasingham, S., Hebert, P. D. N. (2007) BOLD: The Barcode of Life Data System (www.Barcodinglife.org). Molecular Ecology Notes, 2007; 7(3): 355-364

Primer:

1x LepF1_t1: ATT TAG GTG ACA CTA TAG ATT CAA CCA ATC ATA AAG ATA TTG G

1x VF1_t1: ATT TAG GTG ACA CTA TAG TCT CAA CCA ACC ACA AAG ACA TTG G

1x VF1d_t1: ATT TAG GTG ACA CTA TAG TCT CAA CCA ACC ACA ARG AYA TYG G

3x VF1i_t1: ATT TAG GTG ACA CTA TAG TCT CAA CCA ACC ANA ANG ANA TNG G

1x LepR1_t1: TAA TAC GAC TCA CTA TAG GGT AAA CTT CTG GAT GTC CAA AAA ATC A

1x VR1d_t1: TAA TAC GAC TCA CTA TAG GGT AGA CTT CTG GGT GGC CRA ARA AYC A

1x VR1_t1: TAA TAC GAC TCA CTA TAG GGT AGA CTT CTG GGT GGC CAA AGA ATC A

3x VR1i_t1: TAA TAC GAC TCA CTA TAG GGT AGA CTT CTG GGT GNC CNA ANA ANC A

Sequence:

5`-TTWATTTTWWWTTWWRGSGACASTATAGTCTCRRCCAACCACAARGAYATTGGCACCCTG

TACCTACTATTTGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGC

GCTGAACTAGGTCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTT

ACAGCTCATGCCTTTGTAATAATCTTCTTTATAGTAATACCCATTATGATTGGAGGTTTT

GGTAACTGACTCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAAC

AACATAAGTTTCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAGTA

GAAGCCGGAGCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCAT

GCAGGGGCTTCAGTTGATTTAACAATTTTCTCCCTACACCTTGCAGGTGTATCATCAATC

CTAGGGGCTATTAATTTCATTACCACAATTATTAACATAAAACCCCCCGCAATGTCTCAA

TACCAAACACCCCTGTTTGTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCC

CTGCCAGTTCTAGCAGCTGGCATTACTATACTACTGACAGACCGCAACCTGAACACAACC

YTTTTTKGAWTCCCAAGGCARGGGTKGGTKGRRGAMCCCTATTCCYTTAWYCAAMMMYTK

KTCKKTATCTCKKGCMACCT-3`

Taxonomic Level Taxon Assignment Probability of Placement (%)
Phylum Chordata 100
Class Mammalia 100
Order Artiodactyla 100
Family Suidae 100
Genus Sus 100
Species Sus scrofa 100

Identification Summary:

Search Result: The submitted sequence has been matched to Sus scrofa. This identification is solid unless there is a very closely allied congeneric species that has not yet been analyzed. Such cases are rare.

Download as PDF (beta)