Help

SPC-BM-36 - Discontinued

DSMZ: ACC-186

Species: Spodoptera frugiperda (insect - fall armyworm (Spodoptera frugiperda))

Cell type: larval cells

Incubation medium: 80% TC 100 medium + 20% h.i. FBS

Morphology: large, mostly adherent cells; 90% round cells (singly or aggregates), 10% spindled-shaped cells with long processes

COI DNA Barcoding Report

Help

Cell line: SPC-BM-36

ACC-No.: 186

Date of analysis: 13.10.2014

DNA processing number:

Methode: DNA Barcoding by PCR amplification of 5┬┤coding region of cytochrome c oxidase I (658 bp fragment size). Cycle sequencing of respective PCR products revealed following assignment upon submission to BOLD (Ratnasingham, S., Hebert, P. D. N. (2007) BOLD: The Barcode of Life Data System (www.Barcodinglife.org). Molecular Ecology Notes, 2007; 7(3): 355-364

Primer:

1x LepF1_t1: ATT TAG GTG ACA CTA TAG ATT CAA CCA ATC ATA AAG ATA TTG G

1x VF1_t1: ATT TAG GTG ACA CTA TAG TCT CAA CCA ACC ACA AAG ACA TTG G

1x VF1d_t1: ATT TAG GTG ACA CTA TAG TCT CAA CCA ACC ACA ARG AYA TYG G

3x VF1i_t1: ATT TAG GTG ACA CTA TAG TCT CAA CCA ACC ANA ANG ANA TNG G

1x LepR1_t1: TAA TAC GAC TCA CTA TAG GGT AAA CTT CTG GAT GTC CAA AAA ATC A

1x VR1d_t1: TAA TAC GAC TCA CTA TAG GGT AGA CTT CTG GGT GGC CRA ARA AYC A

1x VR1_t1: TAA TAC GAC TCA CTA TAG GGT AGA CTT CTG GGT GGC CAA AGA ATC A

3x VR1i_t1: TAA TAC GAC TCA CTA TAG GGT AGA CTT CTG GGT GNC CNA ANA ANC A

Sequence:

5`-TTWTTTTARGGGACACTATAGWYTCAACCAAYCAYAAAGAYATTGGAACATTATATTTTA

TTTTTGGAATTTGAGCAGGGATAGTAGGTACTTCTTTAAGTTTATTAATTCGAGCTGAAT

TAGGGACTCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTC

ATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATT

GACTTGTACCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCACGTATAAATAATATAA

GTTTTTGACTTTTACCCCCATCTTTAACTTTATTAATTTCTAGTAGCATTGTAGAAAATG

GAGCAGGAACTGGATGAACAGTTTACCCCCCCCTCTCCTCTAATATTGCTCATGGTGGTA

GTTCAGTAGATTTAGCTATTTTCTCACTTCATTTAGCTGGAATTTCATCTATTTTAGGAG

CTATTAACTTTATTACTACTATTATTAATATACGATTAAATAATTTATCATTTGATCAAA

TACCTTTATTTATTTGAGCTGTAGGTATTACTGCATTCTTATTATTATTATCTTTACCTG

TTTTAGCCGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACATCATTTTTCG

ATCCTGCAGGTGGRGKTGWYCYTATTCYTTWAYCAAMMWTTWATTKKATCTYTKGCCWCCA-3`

Taxonomic Level Taxon Assignment Probability of Placement (%)
Phylum Arthropoda 100
Class Insecta 100
Order Lepidoptera 100
Family Noctuidae 100
Genus Spodoptera 100

Identification Summary:

Search Result: A species level match could not be made, the queried specimen is likely to be one of the following:

Spodoptera frugiperda sp. 2

Spodoptera frugiperda

Spodoptera frugiperdaDHJ02

Spodoptera frugiperda sp. 1

Catalog: Bombyx mori!!!

Download as PDF (beta)