Help

2M6

DSMZ: ACC-205

Species: Mus musculus (mouse)

Cell type: hybridoma (anti-chicken retina)

Incubation medium: 80-85% RPMI 1640 + 10-15% h.i. FBS + HFCS ("Hybridoma Fusion and Cloning Supplement") for the first 1-2 weeks post-thawing

Morphology: round cells growing singly or in small clumps in suspension, some cells are slightly adherent

COI DNA Barcoding Report

Help

Cell line: 2M6

ACC-No.: 205

Date of analysis: 13.10.2014

DNA processing number:

Methode: DNA Barcoding by PCR amplification of 5┬┤coding region of cytochrome c oxidase I (658 bp fragment size). Cycle sequencing of respective PCR products revealed following assignment upon submission to BOLD (Ratnasingham, S., Hebert, P. D. N. (2007) BOLD: The Barcode of Life Data System (www.Barcodinglife.org). Molecular Ecology Notes, 2007; 7(3): 355-364

Primer:

1x LepF1_t1: ATT TAG GTG ACA CTA TAG ATT CAA CCA ATC ATA AAG ATA TTG G

1x VF1_t1: ATT TAG GTG ACA CTA TAG TCT CAA CCA ACC ACA AAG ACA TTG G

1x VF1d_t1: ATT TAG GTG ACA CTA TAG TCT CAA CCA ACC ACA ARG AYA TYG G

3x VF1i_t1: ATT TAG GTG ACA CTA TAG TCT CAA CCA ACC ANA ANG ANA TNG G

1x LepR1_t1: TAA TAC GAC TCA CTA TAG GGT AAA CTT CTG GAT GTC CAA AAA ATC A

1x VR1d_t1: TAA TAC GAC TCA CTA TAG GGT AGA CTT CTG GGT GGC CRA ARA AYC A

1x VR1_t1: TAA TAC GAC TCA CTA TAG GGT AGA CTT CTG GGT GGC CAA AGA ATC A

3x VR1i_t1: TAA TAC GAC TCA CTA TAG GGT AGA CTT CTG GGT GNC CNA ANA ANC A

Sequence:

5`-TTTTWTTTWARSYGACAYTATAGWCTCAACCRRYCAYAARGAYATTGGAACCCTCTATCT

ACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGA

ATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGC

CCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAA

CTGACTTGTCCCACTAATAATCGGAGCCCCAGATATAGCATTCCCACGAATAAATAATAT

AAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGC

AGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGGAAATCTAGCCCATGCAGG

AGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGG

TGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTATCA

AACTCCACTATTTGTCTGATCCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACC

AGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTTCT

TTGATTCCCCGCYKGGARGGARGGGGAMCCYAWTTCYTCYWMCMRSMWTCYGTKTCKRTA

TYTCKKCCAMYCAGAC-3`

Taxonomic Level Taxon Assignment Probability of Placement (%)
Phylum Chordata 100
Class Mammalia 100
Order Rodentia 100
Family Muridae 100
Genus Mus 100
Species Mus musculus 100

Identification Summary:

Search Result: The submitted sequence has been matched to Mus musculus. This identification is solid unless there is a very closely allied congeneric species that has not yet been analyzed. Such cases are rare.

Download as PDF (beta)